Изучение экспрессии гена cd38 больных раком толстой кишки

№67-2,

биологические науки

Колоректальный рак остается одним из наиболее распространенных злокачественных новообразований в мире. Согласно последнему глобальному онкоэпидемиологическому анализу, хотя, по оценкам, во всем мире в мире насчитывается 1,2 миллиона новых случаев в год. В глобальном масштабе Колоректальный рак является четвертой по распространенности причиной смертей от рака у мужчин, а третий - у женщин, из которых, по оценкам, 320 600 мужчин и 288 100 женщин в год. Обычными прогностическими факторами выживания пациентов являются гистологическая опухоль (дифференциация) и стадию опухоли (TNM, опухоли / узлы / метастазы, этапы I-IV). Колоректальный рак реже встречается у людей в возрасте до 50 лет, средний возраст при диагнозе составляет 70 лет. Мутации в нескольких разных генах, по-видимому, необходимы для возникновения Колоректальный рак.

Похожие материалы

Introduction

The gene that codes for human CD38 was mapped on chromosome 4 by the genetics of somatic cells [Katz F. et al., 1983]. CD38 is able to be in soluble form and is present in biological fluids with normal and pathological conditions [Funaro A. et al., 1996]. More recently, the subchromosomal localization of the human CD38 gene (4pl5) has been achieved in studies aimed at genetic analysis of the molecule [Nakagawara K. et al., 1995].

The CD38 gene encodes a transmembrane glycoprotein that acts as a marker of lymphocyte activation and has enzymatic activity against ADP-ribose [Deaglio S. et al., 2001]. Recent studies have shown that patients with B-cell chronic lymphocytic leukemia (B-CLL) can be divided into two groups depending on the presence or absence of CD38 on malignant cells [Zupo S. et al., 1996]. In association studies between CD38 and colon cancer, CD38 gene expression levels were studied in healthy individuals and in patients with colon cancer.

Materials and methods

Cases and controls

56 samples of peripheral blood from patients with colon cancer were analyzed. These samples were brought from the hospital of the Regional Clinical Hospital of the Nizhny Novgorod Regional Clinical Oncology Clinic and were analyzed at the Center for Molecular Biology and Biomedicine, Nizhny Novgorod State University. N.I. Lobachevsky.

Patients with colon cancer were 24 (42.85%) men and 26 (46.44%) women, the average age was 62 years (range, 43-82). The cDNA sample was prepared by cDNA synthesis using a reverse transcription kit (ThermoScientific), followed by real-time PCR, performed using a real-time detection system of the Bio-Rad CFX96 Touch PCR.

The synthetic oligonucleotide primers F (GAGCTTCGTGTCCTGTATGG), R (CTCATACCGGGGGGAGAGAGCA), Z (CCCATTGCCCGAGCTCAAGTGTCTAAAGGA) with amplification parameters consisted of 1 cycle at 94 ° C for 10 min, followed by amplification for 49 cycles (at 94 ° C for 30 s, 60 ° C for 30 seconds and 72 ° C for 30 seconds) on the Biorad CFX96 Touch. Subsequently, the resulting result was in the form of a program curve that was applied with continuous measurement of fluorescence.

The level of analysis of CD38 was performed using the programs excel and GraphPad Prism 5. A two-sided Mann-Whitney U-criterion was used to compare the two independent groups by the quantitative characteristics. Differences were considered statistically significant at a level of p <0.05.

Results and discussion

The mRNA of the CD38 gene transcript was found in all samples: healthy donors (n = 59) and patients with colon cancer (n = 56). Determination mRNA expression level of CD38 gene showed that for colon cancer in blood cells, mRNA expression level of CD38 gene was significantly higher than in healthy individuals.The frequency of detection of CD38 mRNA at different stages of the tumor, the percentage of patients with high CD38 mRNA levels was slightly varied in stages I, III and IV (stage I-20.04%, stage III-18.56% and stage IV-16.14%) Respectively, and expression of CD38 mRNA in stage II was 45.68%.

A possible mechanism for increasing the expression of the CD38 gene by blood cells is its induction by cytokines from secreted tumor cells [Siegall C.B. Et al., 1990]. It was shown an increase in CD38-positive cells at all stages of the tumor process for breast cancer, probably due to the activation of the immune system in response to the tumor.

During the expression of the CD38 molecule on surface cells, it modifies the cell adhesion potential and can serve as a potential source of soluble CD38 molecules, leaving an intercellular space that inhibits migration in the tumor site of activated T lymphocytes and natural killers [Novikov VV.et al., 2005]. Expression of the CD38 gene plays an important role in the development of the tumor and its protection from immune surveillance. It was found that the CD38 mRNA level in all tested blood samples was increased. We studied the possible association of the level of mRNA with the sex of patients in the blood of men and women. The level of expression of CD38 mRNA in men and women in the blood of patients with colon cancer was studied.

Our data showed that in the tumor process, the level of expression of CD38 mRNA is high in comparison with men (p <0.05), CD38 mRNA in women was higher than in men. It is known that the immune system of men differs from the immune system of women by the intensity of the reaction to antigenic stimuli. Women are more resistant to certain infections and are more likely to suffer from autoimmune diseases [Whitacre C. C., 2001]. Our data are consistent with the literature, which reflects the characteristics of the reaction of the female body to the tumor.

Conclusion

The major strengths of our investigation are the design, which has enabled the results to be confirmed in a validation study, and functional findings that are in line with the observed disease associations. However, some limitations of the study should also be mentioned. It should also be underlined that we applied the candidate gene approach, and focused on level expression of CD38 gene with functional effects as suggested. We found some evidence that mRNA CD38 expression in colon cancer cells and contributes to colon cancer predisposition.

Список литературы

  1. Katz F., Povey S., Parkar M., Schneider C., Sutherland R., Stanley K., Solomon E., and Creaves M. Chromosome assignment of monoclonal antibodydefined determinant on human leukemic cells. Eur J. Immunol; 1983. 13: p 1008-1013
  2. Funaro A., Horenstein A. L., Calosso L., et al. Identification and characterization of an active soluble form of human CD38 in normal and pathological fluids. Int Immunol; 1996. 8: p 1643-1650.
  3. Nakagawara K., Mon M., Takasawa S., Nata K., Takamura I., Berlova A., Tohgo A., Karasawa I., Yonekura H., Takeuchi I., and Okamoto H. Assignment of CD38, the gene encoding human leukocyte antigen CD38
  4. Deaglio. S., Mallone. R, Baj G., Donati D., Giraudo G., Corno F., Bruzzone S., Geuna M., Ausiello C., and Malavasi F. Human CD38 and its ligand CD31 define a unique lamina propria T lymphocyte signaling pathway. FASEB J; 2001.15: p 580-582.
  5. Zupo S., Isnardi L., Megna M., Malavasi F., Dono M., Cosulich E., and Ferrarini M. CD38 expression distinguishes two groups of B cells chronic lymphocytic leukemia with different response to anti-lgM antibodies and propensity to apoptosis. Blood In press; 1996. 88: p 1365-1374.
  6. Siegall C. B., Schwab G., Nordan R. P., FitzGerald D. J. Expression of the interleukin 6 receptor and interleukin 6 in prostate carcinoma cells / Pastan // Cancer Res.–1990. – V. 50, № 24. – P.7786-7788.
  7. Novikov V.V., Alasova A.V.., Utkin O.V., Lyutina E.V., Novikov D.V., Varshavskaya L.V. Soluble antigens CD38 and CD95 in breast cancer. Russian Biotherapeutic Journal. 2005. Т. 4. №3. С. 46-51.
  8. Whitacre C.C. Sex differences in autoimmune disease // Nat. Immunol. – 2001. – V. 2, № 9. – P.777-780.