Изучение полиморфизм гена транспортера серотонина (5-HTTLPR) в двух возрастных группах КБР

№84-1,

биологические науки

Продолжительность жизни определяется во многом генетическим, наследственным аппаратом клетки. Возникающие возрастные изменения сказываются на ходе биосинтеза белка, приводят к соответствующим изменениям свойств клеточных мембран и способности клетки отвечать на раздражение. Следовательно, к отклонению от нормы процессов возбуждения и торможения. Было проведено изучение полиморфизма гена 5-HTTLPR у индивидов двух возрастных групп: 84-104 года и 17-24 лет в Кабардино-Балкарской республике. Анализ частот генотипов в группе индивидов 84-104 года показал, преобладание генотипа *L/*S (48,9%), распределение частот аллелей выявило, что частота аллеля *S составляет 40,0% частота аллеля *L равна 60,0%. Гендерное распределение аллелей *L и *S гена 5-HTTLPR у старческой группы и долгожителей КБР статистически достоверных различий не показало. Анализ частот аллелей и генотипов возрастной группе 17-24 лет выявил преобладание генотипа *L/*L (50,0%). Аллель *L встречается с частотой 67% в общей выборке возрастной группы 17-24 лет. Гендерных различий внутри возрастной группы 17-24 лет по частотам генотипов и аллелей выявлено не было. Сравнительный анализ частот аллелей и генотипов не выявил статистически достоверных различий межу двумя возрастными группами. Результаты проведённого нами анализа не позволяют нам сделать статистически достоверный вывод по преобладанию генотипа *L/*S в исследуемой нами старческой группе и долгожителей, но вы-является тенденция к увеличению доли носительства гетерозиготного генотипа в более старших группах. В связи с этим, вероятно, что шансы достижения долголетия повышены у людей с носительством данного генотипа. Данные являются промежуточными и могут изменяться при увеличении выборки....

Похожие материалы

Старение — длительный процесс, так как в организме постепенно накапливаются изменения, которые впоследствии проявятся как признаки старости. У разных людей она происходит по-разному и в разные сроки. В геронтологии выделяют высший уровень долголетия — долгожительство: 90 лет и выше. Долгожители, как правило, люди, у которых существует оптимальный уровень функционирования большинства важнейших физиологических систем; они характеризуются широкой адаптационной способностью, что является необходимым условием для здоровья и жизнеспособности.

Роль генетических факторов в детерминации долголетия до сих пор остаётся одной из наиболее обсуждаемых тем. Долголетие пытаются объяснить наличием аллелей, защищающих от возрастзависимых фенотипов и болезней, способствующих смертности населения. В то же время долгожители обладают набором аллелей генов, предрасполагающих к многофакторным заболеваниям в среднем возрасте, и имеют ряд хронических заболеваний, но доживают до глубокой старости [1].

Серотонин (5-гидрокситриптамин, 5-НТ) является ключевым нейротрансмиттером, вовлеченным во многие аспекты психологических процессов, включая настроение, агрессию, импульсивность и тревогу у людей и животных [2, 3, 4, 5]. Серотонин был предложен как нейротрансмиттер, имеющий важное значение для прогнозирования широкого спектра психологических состояний и поведения, включая агрессию, алкоголизм, тревожность, поиск новизны, депрессию и антисоциализм [6, 7]. Одним из основных регуляторов серотонина является переносчик серотонина (5-HTT), который удаляет серотонин, высвобождаемый в синаптическую щель. Наибольшее внимание в пределах этого гена привлекает полиморфный участок в регионе промотора гена переносчика серотонина (HTTLPR) с формированием короткого (S) и длинного (L) аллелей. *L — повышает концентрацию переносчика серотонина. Наличие короткого аллеля *S связано со снижением обратного захвата серотонина, что увеличивает длительность серотонинергической активности и, следовательно, приводит к проявлению черт тревожности и невротизации. Поэтому полиморфизмы 5НТТ представляют большой интерес в качестве успешной модели повышенной физиологической устойчивости к внешним факторам при исследовании лиц старших возрастных групп. Подобные исследования, посвященные связи различных вариантов генов, вовлеченных в реакцию организма на стресс, с психическими и соматическими расстройствами, могут послужить ключом к пониманию генетических механизмов, задействованных в обеспечении активного долголетия. Анализ полиморфных вариантов можно рассматривать как прогностический тест для оценки риска развития болезней старческого возраста, и оценки возможного уровня качества жизни долгожителей.

Для проведения настоящего исследования сбор образцов крови старческой группы и долгожителей КБР проводился в ходе экспедиционных выездов по месту жительства исследуемых и в Республиканском Геронтологическом Центре в период 2012-2018 гг. Сбор образцов для возрастной группы от 17 до 24 лет проводился в Кабардино-Балкарском Государственном Университете среди студентов.

Данные о каждом участнике эксперимента собраны путем опроса и занесены в специально разработанную формализованную карту (ФК-анкету). Анкета заполнялась индивидуально на каждого участника исследования и соответствовала стандартной карте ВОЗ (1974). Выборка дифференцирована на возрастные группы согласно классификации, принятой в 1965 году на VII Всесоюзной конференции по проблемам возрастной морфологии, физиологии и биохимии АПН СССР в Москве [8].

В ходе научно-исследовательской работы создан банк биологического материала: цельная кровь и ДНК старческой группы и долгожителей, проживающих на территории Кабардино-Балкарской Республики. Общая выборка старческой возрастной группы и долгожителей составила 45 человек от 84 до 104 лет, средний возраст выборки 88,56±1,16 года, при этом средний возраст возрастной группы 17-24 лет составил 20,0±0,05 (N=53 человека).

Забор клинического материала для исключения контаминации проводили с помощью стерильных одноразовых пробирок BD Vacutainer K2 EDTA объемом 9 мл. Забор буккального соскоба — с использованием стерильных зондов для забора буккального соскоба.

Генотипирование проводилось методом ПЦР. Процесс амплификации осуществляется с использованием наборов GenePakTM PCR Core (“Лаборатория Изоген”, Москва), Screenmix (Евроген, Москва). Для постановки ПЦР использовали следующие праймеры: 5HTT — F 5' — CAATGTCTGGCGCTTCCCCTACATAT — 3' (прямой праймер), 5HTT — R 5' — GACATAATCTGTCTTCTGGCCTCTCAAG — 3' ( обратный праймер). Ожидаемые продукты реакции — аллели S и L, 256 п.н. и 300 п.н., соответственно. Разделение продуктов амплификации проводили в 2% агарозном геле. Интеркалирующий агент — этидия бромид. Разделение фрагментов ДНК по длине проведено в горизонтальном аппарате для электрофореза Mini-SabCell (Bio- Rad, США). Данные анализировали с помощью аналитической системы Био-Док-Ит М-26Х при облучении геля УФ-излучением с длиной волны 290-330 нм.

Анализ частот аллелей и генотипов гена серотонинового транспортера 5-НТТLPR в возрастной группе 84-104 года в КБР

При ПЦР-анализе гена серотонинового транспортера 5-НТТLPR в старческой возрастной группе и долгожителей КБР выявлялись все возможные генотипы — *L/*L, *L/*S, *S/*S.

При исследовании полиморфизма гена серотонинового транспортера 5- HTTLPR в изучаемой возрастной группе 84-104 г. было выявлено, что с наибольшей частотой встречается генотип*L/*S (48,9%), с наименьшей частотой генотип *S/*S (15,6%). Был проведен сравнительный анализ частот генотипов данной возрастной группы КБР с литературными данными, описывающими другие популяции. Было показано, что частоты генотипов по гену 5-HTT (*L/*L, *L/*S, *S/*S) у исследуемой нами выборки оказались близки к значениям в ранее изученных группах из России и стран Европы, но отличаются от таковых в Бразилии, Китае, Японии и у афроамериканцев США [9,10].

Более подробное исследование старческой группы и долгожителей выявило незначительные различия по полу в распределении частот генотипов гена 5-HTTLPR. Частоты генотипа *L/*L у мужчин составила 17,7%, у женщин 14,3%. Гетерозиготный генотип *L/*S у женщин генотипирован с частотой 51,2%, что незначительно выше, чем у мужчин (47,7%). Распределение частот аллелей в исследуемой группе показало, что частота аллеля *S составляет 40,0±0,051, частота аллеля *L равна 60,0±0,051 (p±sp,%, соответственно).

Статистически достоверной разницы по преобладанию по частотам аллелей *L и *S у мужчин и женщин выявлено не было (χ2=0,747; Р=0,387).

В изучаемой группе эмпирически наблюдаемое распределение частот генотипов не отличается от теоретически ожидаемого по уравнению Харди-Вайнберга (χ2=0,11; Р<0.05). Показатель гетерозиготности составил 48,9% (теоретическая гетерозиготность — 48,0%).

Анализ частот аллелей и генотипов гена серотонинового транспортера 5-НТТLPR в возрастной группе 17-24лет

При генотипировании гена серотонинового транспортера 5-НТТLPR в возрастной группе 17-24 лет выявлялись все возможные генотипы — *L/*L, *L/*S, *S/*S.

При исследовании полиморфизма гена серотонинового транспортера 5- HTTLPR у данной возрастной группы КБР было выявлено, что с наибольшей частотой встречается генотип *L/*L (50%), с наименьшей частотой генотип *S/*S (16%) (табл. 1).

Таблица 1. Частоты генотипов по гену 5-HTTLPR у возрастной группы 17-24 лет Кабардино-Балкарии

генотип

общая группа

мужчины

женщины

n

p±sp,%(CI)

n

p±sp,%(CI)

n

p±sp,%(CI)

*L/*L

27

50,0±0,048

9

56,0±0,088

18

48,0±0,058

*L/*S

17

32,0±00,045

6

37,0±0,085

11

29,0±0,025

*S/*S

9

16,0±0,035

1

6,2±0,041

8

21±0,002

Нами был проведен анализ частот аллелей в изученной возрастной группе 17-24 лет. Он показал, что аллель *L встречается с частотой 67% в общей выборке, а также является преобладающим как в выборке мужчин, так и женщин (табл.2).

Гендерных различий внутри возрастной группы 17-24 лет по частотам аллелей и генотипов выявлено не было.

Таблица 2. Частоты аллелей по гену 5-HTTLPR у возрастной группы 17-24 лет Кабардино-Балкарии

Аллель

общая группа

мужчины

женщины

n

p±sp,%(CI)

n

p±sp,%(CI)

n

p±sp,%(CI)

*S

35

33±0,045

23

32,8±0,082

12

33,3±0,05

*L

71

67±0,045

47

67,2±0,082

424

66,7±0,05

В возрастной группе 17-24 лет эмпирически наблюдаемое распределение частот генотипов не отличается от теоретически ожидаемого по уравнению Харди-Вайнберга (χ2=0,27; Р<0.05). Показатель гетерозиготности составил 32,0% (теоретическая гетерозиготность — 44,0%). Наблюдается недостаток гетерозигот в данной выборке, что можно объяснить ее малочисленностью.

Сравнительный анализ частот аллелей и генотипов в двух возрастных группах

Был проведен сравнительный анализ частот аллей и генотипов по гену 5-HTTLPR двух возрастных групп: 84-104 года и 17-24 лет

В проведенном сравнительном анализе частот аллелей и генотипов не было выявлено статистически достоверных отличий по частотам генотипов по гену 5-HTTLPR в двух возрастных группах КБР (χ2=3,072; Р=0,215).

Сравнительный анализ частот аллелей показал, отсутствие статистически достоверной разницы двух возрастных групп по аллелям *L и *S2=0,747; Р=0,387). Но отмечено преобладание гомозиготного генотипа *L/*L у возрастной группы 17-24 лет (50%), и гетерозиготного генотипа *L/*S у старческой и долгожителей (48,9%).

Сравнительный анализ уровня гетерозиготности в двух возрастных группах выявил, что этот показатель выше в старческой группе и долгожителей, чем выборке индивидов 17-24 лет (48,9% и 32,0% , соответственно).

Литературные данные свидетельствуют об увеличение частоты генотипа *L/*L, часто выявляемого у спортсменов, среди мужчин возрастной группы 80-89 лет, и данными о том, что пожилые представители мужского пола достоверно чаще несут *L вариант гена серотонинового транспортера [11]. Распределение полиморфизма гена серотонинового транспортера 5-HTTLPR в популяции Северо-Запада России показало, что данная особенность распространения генотипа *L/*L гена 5-НТТLPR у мужчин старшей возрастной группы объясняется большей зависимостью мужского долгожительства от генотипа, по сравнению с женским.

Проведя анализ по социо-физиологической характеристике, было выявлено, что на момент обследования в структуре хронических заболеваний, характерных для пожилого возраста в старческой группе и долгожителей КБР наиболее часто встречалась гипертензия (2%), перенесенный инфаркт (3%) и диабет (5%). И ни у одного из данной возрастной группы не отмечено старческого слабоумия. Параметры, соответствующие степени физической активности и степени самообслуживания оказались также различны у старческой группы и долгожителей разного пола. В возрастной группе мужчин все индивидуумы (100%) сохранили самообслуживание в полном объеме и были физически активны на момент исследования. Также было отмечено, что лишь 3% респондентов возрастной группы 84-104 года употребляли табак и 8,5% злоупотребляли алкоголем. Это подтверждает предположение о положительном влиянии отсутствия вредных привычек на продолжительность и качество жизни долгожителей КБР.

Таким образом, результаты проведённого нами анализа не позволяют нам сделать статистически достоверный вывод по преобладанию генотипа *L/*S в исследуемой нами старческой группе и долгожителей, но выявляется тенденция к увеличению доли носительства гетерозиготного генотипа в более старших группах. В связи с этим, вероятно, что шансы достижения долголетия повышены у людей с носительством данного генотипа. Данные являются промежуточными и могут изменяться при увеличении выборки.

Список литературы

  1. Шабалин А. В., Воевода М. И., Черных Н. И. и др. Долгожительство модель изучения процесса старения / Шабалин, М. И. Воевода, Н. И. Черных и др. // Бюллетень СО РАМН. - 2006. - Т. 122, № 4.-С. 11-21.
  2. Rahman MH, Ali MY. The Relationships between Thyroid Hormones and the Brain Serotonin (5-HT) System and Mood: Of Synergy and Significance in the Adult Brain- A Review. Faridpur Med Coll. 2015; 9: 98–101. https://doi.org/10.3329/fmcj.v9i2.25684
  3. Glick AR. The role of serotonin in impulsive aggression, suicide, and homicide in adolescents and adults: a literature review. Int J Adolesc Med Health. 2015;27:143–50. https://doi.org/10.1515/ijamh-2015-5005. [PubMed]
  4. Dalley JW, Roiser JP. Dopamine, serotonin and impulivity. Neuroscience. 2012;215:42–58.https://doi.org/10.1016/j.neuroscience.2012.03.065. [PubMed]
  5. Helton SG, Lohoff FW. Serotonin pathway polymorphisms and the treatment of major depressive disorder and anxiety disorders. Pharmacogenomics. 2015;16:541–53. https://doi.org/10.2217/pgs.15.15.[PubMed]
  6. Shattuck MR, Satkoski-Trask J, Deinard A, Tito RY, Smith DG, Malhi RS The evolutionary history of SLC6A4 and the role of plasticity in Macaca. Am J Phys Anthropol, 2014, no. 153, pp. 605–616.
  7. Aslund C., Nilsson K.W..Individual biological sensitivity to environmental influences: testing the differential susceptibility properties of the 5httlpr polymorphism in relation to depressive symptoms and delinquency in two adolescent general samples //Journal of Neural Transmission. pp 1–17 / Journal of Neural Transmission https://doi.org/10.1007/s00702-018-1854-8
  8. Хрисанфова, Е. Н. Основы геронтологии (Антропологические аспекты) / Е. Н Хрисанфова. − М.: ВЛАДОС, 1999. − 160 c.
  9. Мустафина О. Е., Сомова Р. Ш. Некоторые итоги молекулярно-генетических исследований старения и долголетия//Успех геронтологии. -2015, №1. – С.11-27
  10. Рубцов. Социальная геронтология: Учеб. пособие.-М.: Издат. –торговая корпорация «Дашков и К», 2005.- 296 с.
  11. Смирнова Т. Ю., Спивак Д. Л., Якупова Г. С. и др. Распределение структурных полиморфизмов генов ангиотензин- превращающего фермента и рецептора серотонина 5-HT2A у долгожителей Северо-Запада России // Успехи геронтологии.– 2011. Т. 24. № 4. С. 620–625.